COX4 (COX4I1) (NM_001861) Human 3' UTR Clone

CAT#: SC201042

3' UTR clone of cytochrome c oxidase subunit IV isoform 1 (COX4I1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name COX4 (COX4I1) (NM_001861) Human 3' UTR Clone
Vector pMirTarget
Synonyms COX4; COX4-1; COXIV; COX IV-1; COXIV-1; MC4DN16
ACCN NM_001861
Insert Size 147 bp
Sequence Data
>SC201042 3' UTR clone of NM_001861
The sequence shown below is from the reference sequence of NM_001861. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCT
GCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGT
ACCACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001861.2
Synonyms COX4; COX4-1; COXIV; COX IV-1; COXIV-1; MC4DN16
Summary Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit IV isoform 1 of the human mitochondrial respiratory chain enzyme. It is located at the 3' of the NOC4 (neighbor of COX4) gene in a head-to-head orientation, and shares a promoter with it. Pseudogenes related to this gene are located on chromosomes 13 and 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Locus ID 1327
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...