PEDF (SERPINF1) (NM_002615) Human 3' UTR Clone

CAT#: SC201040

3' UTR clone of serpin peptidase inhibitor clade F (alpha-2 antiplasmin pigment epithelium derived factor) member 1 (SERPINF1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PEDF (SERPINF1) (NM_002615) Human 3' UTR Clone
Vector pMirTarget
Synonyms EPC-1; OI6; OI12; PEDF; PIG35
ACCN NM_002615
Insert Size 149 bp
Sequence Data
>SC201040 3’UTR clone of NM_002615
The sequence shown below is from the reference sequence of NM_002615. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCC
GAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGC
TTTATCCCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002615.7
Synonyms EPC-1; OI6; OI12; PEDF; PIG35
Summary This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]
Locus ID 5176
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...