NFU1 (NM_001002755) Human 3' UTR Clone

CAT#: SC201025

3' UTR clone of NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NFU1 (NM_001002755) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-33; HIRIP; HIRIP5; MMDS1; Nfu; NifU; NIFUC
ACCN NM_001002755
Insert Size 150 bp
Sequence Data
>SC201025 3’UTR clone of NM_001002755
The sequence shown below is from the reference sequence of NM_001002755. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGATGAAAAAGAAGCAAACTCACCTTAAAATAATCTGGATTTTCTTTGGGCATAACAGTCAGACTTG
TTGATAATATATATCAAGTTTTTATTATTAATATGCTGAGGAACTTGAAGATTAATAAAATATGCTCTT
CAGAGAATGATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002755.4
Synonyms CGI-33; HIRIP; HIRIP5; MMDS1; Nfu; NifU; NIFUC
Summary This gene encodes a protein that is localized to mitochondria and plays a critical role in iron-sulfur cluster biogenesis. The encoded protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate dehydrogenase and lipoic acid synthase. Mutations in this gene are a cause of multiple mitochondrial dysfunctions syndrome-1, and pseudogenes of this gene are located on the short arms of chromosomes 1 and 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Locus ID 27247
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...