NAT8B (NM_016347) Human 3' UTR Clone

CAT#: SC200997

3' UTR clone of N-acetyltransferase 8B (GCN5-related putative gene/pseudogene) (NAT8B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NAT8B (NM_016347) Human 3' UTR Clone
Vector pMirTarget
Synonyms CML2; Hcml2; NAT8BP
ACCN NM_016347
Insert Size 156 bp
Sequence Data
>SC200997 3’UTR clone of NM_016347
The sequence shown below is from the reference sequence of NM_016347. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCCCTTCTGCTCAGGCAGGGCGTCTATGATTTCTTTCCTTCTGTATTGGTCAGAATAGAATCCATTCG
GCTGTAGCAGCAAGCAATCCCCAACCTCTGACTGCAATGACCTTTCTGTGCAATAAAAGCTTATTGTCC
ATTAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016347.2
Synonyms CML2; Hcml2; NAT8BP
Summary The protein encoded by this gene is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. This gene is localized on chromosome 2 in the vicinity of the NAT8 gene and may represent a pseudogene of NAT8. This gene contains two polymorphic nonsense mutations that disrupt the active site of the protein. The full-length product of this gene contains a complete acetyltransferase domain and is identical in length to NAT8. [provided by RefSeq, Jul 2008]
Locus ID 51471
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...