SLC7A9 (NM_001126335) Human 3' UTR Clone

CAT#: SC200941

3' UTR clone of solute carrier family 7 (cationic amino acid transporter y+ system) member 9 (SLC7A9) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SLC7A9 (NM_001126335) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAT1; CSNU3
ACCN NM_001126335
Insert Size 139 bp
Sequence Data
>SC200941 3’UTR clone of NM_001126335
The sequence shown below is from the reference sequence of NM_001126335. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGTCCCACCGGAGGAAGACCCTGAGTAACAAGCTCCGTCTCTTGTAGCCAAGTCAGCTGAATTTATT
TTCTTAAGCAATATTTGTGGTTATTTCTTCCTTTTTTTCTTACGAATAAAATATACTCAGATGTTTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001126335.2
Synonyms BAT1; CSNU3
Summary This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
Locus ID 11136
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...