RRP9 (NM_004704) Human 3' UTR Clone

CAT#: SC200930

3' UTR clone of ribosomal RNA processing 9 small subunit (SSU) processome component homolog (yeast) (RRP9) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RRP9 (NM_004704) Human 3' UTR Clone
Vector pMirTarget
Synonyms RNU3IP2; U3-55K
ACCN NM_004704
Insert Size 107 bp
Sequence Data
>SC200930 3’UTR clone of NM_004704
The sequence shown below is from the reference sequence of NM_004704. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCCTGTACCCCCAGCTGCTGGTTCCTGACACTCTTATCCTCCTTATTTAAGTCCTTCCCAGGCTATG
CCCCACCCTCTTTGTATTAAAAGCCTCCTCTTTTGGGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004704.5
Synonyms RNU3IP2; U3-55K
Summary This gene encodes a member of the WD-repeat protein family. The encoded protein is a component of the nucleolar small nuclear ribonucleoprotein particle (snoRNP) and is essential for 18s rRNA processing during ribosome synthesis. It contains seven WD domains required for nucleolar localization and specific interaction with the U3 small nucleolar RNA (U3 snoRNA). [provided by RefSeq, Oct 2012]
Locus ID 9136
MW 3.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...