Symplekin (SYMPK) (NM_004819) Human 3' UTR Clone

CAT#: SC200898

3' UTR clone of symplekin (SYMPK) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Symplekin (SYMPK) (NM_004819) Human 3' UTR Clone
Vector pMirTarget
Synonyms Pta1; SPK; SYM
ACCN NM_004819
Insert Size 180 bp
Sequence Data
>SC200898 3’UTR clone of NM_004819
The sequence shown below is from the reference sequence of NM_004819. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGGAACCCGAGGCCAAGGGGAACAGCTGACGGGGCTCGAGGGGGAAAGGGGGTGGGACAGGGACTCGG
GGCTGGGGGACGGGGCGGGGCTTGACCTGCGGGTGCTTTGCCTTAAAAAGAAATAAAAGATGTGAACTT
GGGCAAGTTACTGAAAAGAAAAAAAAAAAGGGATGGCGGGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004819.3
Synonyms Pta1; SPK; SYM
Summary This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
Locus ID 8189
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...