TEKT2 (NM_014466) Human 3' UTR Clone

CAT#: SC200867

3' UTR clone of tektin 2 (testicular) (TEKT2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TEKT2 (NM_014466) Human 3' UTR Clone
Vector pMirTarget
Synonyms h-tektin-t; TEKTB1; TEKTIN-T
ACCN NM_014466
Insert Size 119 bp
Sequence Data
>SC200867 3’UTR clone of NM_014466
The sequence shown below is from the reference sequence of NM_014466. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAAAAGCTGCCAGCTGGAGCTGGCCTAGCCTTGGAGGACTGCAGGAGGAGGGCAGGGTTGGGTGGGC
AATGGAAGGAGGGAGGAGAGAAATGAATGGAATAAATGCAGAGGATCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014466.3
Synonyms h-tektin-t; TEKTB1; TEKTIN-T
Summary This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Locus ID 27285
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...