AKR1A1 (NM_006066) Human 3' UTR Clone

CAT#: SC200844

3' UTR clone of aldo-keto reductase family 1 member A1 (aldehyde reductase) (AKR1A1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name AKR1A1 (NM_006066) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALDR1; ALR; ARM; DD3; HEL-S-6
ACCN NM_006066
Insert Size 123 bp
Sequence Data
>SC200844 3’UTR clone of NM_006066
The sequence shown below is from the reference sequence of NM_006066. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCTGTACCCCTTTAATGACCCGTACTGAGACCACAGCTTCTTGGCCTCCCTTCCAGCTCTGCAGCTA
ATGAGGTCCTGCCACAACGGAAAGAGGGAGTTAATAAAGCCATTGGAGCATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006066.4
Synonyms ALDR1; ALR; ARM; DD3; HEL-S-6
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
Locus ID 10327
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...