NDUFS7 (NM_024407) Human 3' UTR Clone

CAT#: SC200840

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 7 20kDa (NADH-coenzyme Q reductase) (NDUFS7) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NDUFS7 (NM_024407) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-20; CI-20KD; MC1DN3; MY017; PSST
ACCN NM_024407
Insert Size 126 bp
Sequence Data
>SC200840 3’UTR clone of NM_024407
The sequence shown below is from the reference sequence of NM_024407. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGAGGCTGCAGATCTGGTACCGCAGGTAGCGCCGCCGCCGCCGCCGCCGGAGCCTGTCGCCGTCCTGT
CCCCAGCCTGCTTGTGTCCCGTGAGGTTGTCAATAAACCTGCCCTCGGGCTGCCGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024407.5
Synonyms CI-20; CI-20KD; MC1DN3; MY017; PSST
Summary This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
Locus ID 374291
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...