PSMD6 (NM_014814) Human 3' UTR Clone

CAT#: SC200832

3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 6 (PSMD6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PSMD6 (NM_014814) Human 3' UTR Clone
Vector pMirTarget
Synonyms p42A; p44S10; Rpn7; S10; SGA-113M
ACCN NM_014814
Insert Size 147 bp
Sequence Data
>SC200832 3’UTR clone of NM_014814
The sequence shown below is from the reference sequence of NM_014814. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAAAAACTTTCCAGAGTAATTAATATGTAAAGCCATGTAACTAACAAAGGATTTGCTTTAGAGATAATT
ATTTGGAATTTTTATAGCTTACTTCACAATGTGCCCAGGTCAGCTGTATAAAATAAATACTGCATTGTT
GTTTCTTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014814.3
Synonyms p42A; p44S10; Rpn7; S10; SGA-113M
Summary This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Locus ID 9861
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...