GIYD2 (SLX1B) (NM_178044) Human 3' UTR Clone

CAT#: SC200825

3' UTR clone of GIY-YIG domain containing 2 (GIYD2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GIYD2 (SLX1B) (NM_178044) Human 3' UTR Clone
Vector pMirTarget
Synonyms GIYD2
ACCN NM_178044
Insert Size 125 bp
Sequence Data
>SC200825 3’UTR clone of NM_178044
The sequence shown below is from the reference sequence of NM_178044. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCACACTGGACAGACCTGCTGGAGACCTGATCCTCAGTGTCCTTACCCCCTCCTACCTCTTTTCTGTGC
CACCTGCTGTGGGTCCAGCAGGTTTTTACTTGAGTACAATAAAAAGTCTGAGTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178044.3
Synonyms GIYD2
Summary This gene encodes a protein that is an important regulator of genome stability. The protein represents the catalytic subunit of the SLX1-SLX4 structure-specific endonuclease, which can resolve DNA secondary structures that are formed during repair and recombination processes. Two identical copies of this gene are located on the p arm of chromosome 16 due to a segmental duplication; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants. Read-through transcription also occurs between this gene and the downstream SULT1A4 (sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4) gene. [provided by RefSeq, Nov 2010]
Locus ID 79008
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...