SNRPD2 (NM_004597) Human 3' UTR Clone

CAT#: SC200824

3' UTR clone of small nuclear ribonucleoprotein D2 polypeptide 16.5kDa (SNRPD2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SNRPD2 (NM_004597) Human 3' UTR Clone
Vector pMirTarget
Synonyms Sm-D2; SMD2; SNRPD1
ACCN NM_004597
Insert Size 143 bp
Sequence Data
>SC200824 3’UTR clone of NM_004597
The sequence shown below is from the reference sequence of NM_004597. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCCGCCTGTCTGTTGACAGAACTCACTCCTCTGTCCT
ATGAAGACCGCTGCCATTGGTGTTGAGAATAATAAAGCTCTGTGTTTTTTTCTAGTGGTAAAAAAAAAA
AAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004597.6
Synonyms Sm-D2; SMD2; SNRPD1
Summary The protein encoded by this gene belongs to the small nuclear ribonucleoprotein core protein family. It is required for pre-mRNA splicing and small nuclear ribonucleoprotein biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Locus ID 6633
MW 5.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...