NDUFB9 (NM_005005) Human 3' UTR Clone

CAT#: SC200784

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex9 22kDa (NDUFB9) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NDUFB9 (NM_005005) Human 3' UTR Clone
Vector pMirTarget
Synonyms B22; CI-B22; LYRM3; MC1DN24; UQOR22
ACCN NM_005005
Insert Size 117 bp
Sequence Data
>SC200784 3’UTR clone of NM_005005
The sequence shown below is from the reference sequence of NM_005005. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGACCAGACCCCGGGAGCGGCCCATGTAGAAAGAGAGAGACCTCATCTTTCATGCTTGCAAGTGAAAT
ATGTTACAGAACATGCACTTGCCCTAATAAAAAATCAGTGAAATGGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005005.3
Synonyms B22; CI-B22; LYRM3; MC1DN24; UQOR22
Summary The protein encoded by this gene is a subunit of the mitochondrial oxidative phosphorylation complex I (nicotinamide adenine dinucleotide: ubiquinone oxidoreductase). Complex I is localized to the inner mitochondrial membrane and functions to dehydrogenate nicotinamide adenine dinucleotide and to shuttle electrons to coenzyme Q. Complex I deficiency is the most common defect found in oxidative phosphorylation disorders and results in a range of conditions, including lethal neonatal disease, hypertrophic cardiomyopathy, liver disease, and adult-onset neurodegenerative disorders. Pseudogenes of this gene are found on chromosomes five, seven and eight. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Locus ID 4715
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...