5HT4 Receptor (HTR4) (NM_001040171) Human 3' UTR Clone

CAT#: SC200732

3' UTR clone of 5-hydroxytryptamine (serotonin) receptor 4 (HTR4) transcript variant d for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name 5HT4 Receptor (HTR4) (NM_001040171) Human 3' UTR Clone
Vector pMirTarget
Synonyms 5-HT4; 5-HT4R
ACCN NM_001040171
Insert Size 138 bp
Sequence Data
>SC200732 3’UTR clone of NM_001040171
The sequence shown below is from the reference sequence of NM_001040171. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGGATCCACACATGTACTAAGATTTTGAGCTCCTTGAGGACTGTGGCCAATTCTTATTGCTCATTTT
TTTTTCTTAGTGCCCAACACAGGTTTTTGTACACTGAAGTTATCAAATAAATTCATTGGATGTAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001040171.1
Synonyms 5-HT4; 5-HT4R
Summary This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]
Locus ID 3360
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...