CSHL1 (NM_022581) Human 3' UTR Clone

CAT#: SC200717

3' UTR clone of chorionic somatomammotropin hormone-like 1 (CSHL1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CSHL1 (NM_022581) Human 3' UTR Clone
Vector pMirTarget
Synonyms CS-5; CSHP1; CSL; GHB4; hCS-L
ACCN NM_022581
Insert Size 133 bp
Sequence Data
>SC200717 3’UTR clone of NM_022581
The sequence shown below is from the reference sequence of NM_022581. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTCTGTGGAGGGCAGCTGTGGCTTCTAGGGGCCCGCGTGGCATCCTGTGACCCCTCCCCAGTGCCTC
TCCTGGCCCTGAAGGTGCCACTCCAGTGCCCACCAGCCTTGTCTTAATAAAATTAAGTTGTATT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022581.3
Synonyms CS-5; CSHP1; CSL; GHB4; hCS-L
Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. This particular family member is expressed in placental villi, although it was originally thought to be a pseudogene. In fact, alternative splicing suggests that the majority of the transcripts would be unable to express a secreted protein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 1444
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...