Hsp75 (TRAP1) (NM_016292) Human 3' UTR Clone

CAT#: SC200712

3' UTR clone of TNF receptor-associated protein 1 (TRAP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Hsp75 (TRAP1) (NM_016292) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSP 75; HSP75; HSP90L; TRAP-1
ACCN NM_016292
Insert Size 122 bp
Sequence Data
>SC200712 3’UTR clone of NM_016292
The sequence shown below is from the reference sequence of NM_016292. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTTGTCAAGGCCCTGGAGCGACACTGACAGCCAGGGGGCCAGAAGGACTGACACCACAGATGACAG
CCCCACCTCCTTGAGCTTTATTTACCTAAATTTAAAGGTATTTCTTAACCCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016292.3
Synonyms HSP 75; HSP75; HSP90L; TRAP-1
Summary This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Locus ID 10131
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...