Prothrombin (F2) (NM_000506) Human 3' UTR Clone

CAT#: SC200711

3' UTR clone of coagulation factor II (thrombin) (F2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Prothrombin (F2) (NM_000506) Human 3' UTR Clone
Vector pMirTarget
Synonyms PT; RPRGL2; THPH1
ACCN NM_000506
Insert Size 128 bp
Sequence Data
>SC200711 3’UTR clone of NM_000506
The sequence shown below is from the reference sequence of NM_000506. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGAAGGTCATTGATCAGTTTGGAGAGTAGGGGGCCACTCATATTCTGGGCTCCTGGAACCAATCCCGT
GAAAGAATTATTTTTGTGTTTCTAAAACTATGGTTCCCAATAAAAGTGACTCTCAGCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000506.5
Synonyms PT; RPRGL2; THPH1
Summary This gene encodes the prothrombin protein (also known as coagulation factor II). This protein is proteolytically cleaved in multiple steps to form the activated serine protease thrombin. The activated thrombin enzyme plays an important role in thrombosis and hemostasis by converting fibrinogen to fibrin during blood clot formation, by stimulating platelet aggregation, and by activating additional coagulation factors. Thrombin also plays a role in cell proliferation, tissue repair, and angiogenesis as well as maintaining vascular integrity during development and postnatal life. Peptides derived from the C-terminus of this protein have antimicrobial activity against E. coli and P. aeruginosa. Mutations in this gene lead to various forms of thrombosis and dysprothrombinemia. Rapid increases in cytokine levels following coronavirus infections can dysregulate the coagulation cascade and produce thrombosis, compromised blood supply, and organ failure. [provided by RefSeq, May 2020]
Locus ID 2147
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...