GADD34 (PPP1R15A) (NM_014330) Human 3' UTR Clone

CAT#: SC200692

3' UTR clone of protein phosphatase 1 regulatory (inhibitor) subunit 15A (PPP1R15A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GADD34 (PPP1R15A) (NM_014330) Human 3' UTR Clone
Vector pMirTarget
Synonyms GADD34
ACCN NM_014330
Insert Size 115 bp
Sequence Data
>SC200692 3’UTR clone of NM_014330
The sequence shown below is from the reference sequence of NM_014330. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCTGGACCTCAGTGGGAGGCGTGGCTGAGACCAACTGGTTTGCCTATAATTTATTAACTATTTATTT
TTTCTAAGTGTGGGTTTATATAAGGAATAAAGCCTTTTGATTTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014330.5
Synonyms GADD34
Summary This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008]
Locus ID 23645
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...