RPL35A (NM_000996) Human 3' UTR Clone

CAT#: SC200691

3' UTR clone of ribosomal protein L35a (RPL35A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL35A (NM_000996) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBA5; eL33; L35A
ACCN NM_000996
Insert Size 94 bp
Sequence Data
>SC200691 3' UTR clone of NM_000996
The sequence shown below is from the reference sequence of NM_000996. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATTGGACACAGAATCCGAGTGATGCTGTACCCCTCAAGGATTTAAACTAACGAAAAATCAATAAATAA
ATGTGGATTTGTGCTCTTGTATTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000996.2
Synonyms DBA5; eL33; L35A
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L35AE family of ribosomal proteins. It is located in the cytoplasm. The rat protein has been shown to bind to both initiator and elongator tRNAs, and thus, it is located at the P site, or P and A sites, of the ribosome. Although this gene was originally mapped to chromosome 18, it has been established that it is located at 3q29-qter. Alternative splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Oct 2015]
Locus ID 6165
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...