NUDT14 (NM_177533) Human 3' UTR Clone

CAT#: SC200688

3' UTR clone of nudix (nucleoside diphosphate linked moiety X)-type motif 14 (NUDT14) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NUDT14 (NM_177533) Human 3' UTR Clone
Vector pMirTarget
Synonyms UGPP; UGPPase
ACCN NM_177533
Insert Size 112 bp
Sequence Data
>SC200688 3’UTR clone of NM_177533
The sequence shown below is from the reference sequence of NM_177533. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGTGGCCCCCAACCTGGATCTCCAGTGAGACTCCAGGGTTCTAGACAGAGGCCAGTCTTGGCCACTC
ACCCCACACCCCGCGGACCCCAATAAAGGCTTGCATAGCTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177533.5
Synonyms UGPP; UGPPase
Summary The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This enzyme contains a Nudix hydrolase domain and is a UDPG pyrophosphatase that hydrolyzes UDPG to produce glucose 1-phosphate and UMP. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Locus ID 256281
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...