CHTF18 (NM_022092) Human 3' UTR Clone

CAT#: SC200682

3' UTR clone of CTF18 chromosome transmission fidelity factor 18 homolog (S. cerevisiae) (CHTF18) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CHTF18 (NM_022092) Human 3' UTR Clone
Vector pMirTarget
Synonyms C16orf41; C321D2.2; C321D2.3; C321D2.4; CHL12; Ctf18; RUVBL
ACCN NM_022092
Insert Size 129 bp
Sequence Data
>SC200682 3’UTR clone of NM_022092
The sequence shown below is from the reference sequence of NM_022092. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCAGCCTGTACATCAGGGACTTGCTCTAGTTCTCTGAGCCGCGGACATGCCCTCGCATTGCTTCCCGC
AGAGTGCAGAGACAGGAAGCTGGAGATGTCTTTATAAAGTCACACCTTTACAGACTGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022092.3
Synonyms C16orf41; C321D2.2; C321D2.3; C321D2.4; CHL12; Ctf18; RUVBL
Summary This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
Locus ID 63922
MW 5.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...