COX5B (NM_001862) Human 3' UTR Clone

CAT#: SC200662

3' UTR clone of cytochrome c oxidase subunit Vb (COX5B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name COX5B (NM_001862) Human 3' UTR Clone
Vector pMirTarget
Synonyms COXVB
ACCN NM_001862
Insert Size 305 bp
Sequence Data
>SC200662 3’UTR clone of NM_001862
The sequence shown below is from the reference sequence of NM_001862. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCTGGTGCCCCAGCAGCTGGCACACTGAGCACCTGCACTAAATTACTCAAAATGTGCTGTAAAGTTT
CTTCTTTCCAGTAAAGACTAGCCATTGCATTGGCTCCTTCTCCCATAGATGGCTGGTCTTATTTCTTAC
CCGTATTCTTTGGTAGGCATGGAATATGCTTATTTTGGGAAAAGCTGTCTGTTAATGCTAGCTTGCCAT
CCACTTACTGAAAGTGTATAACCAGTGTATAGTGCTTAGATTAATAATAAGAATAGATCGACAACCCGT
AATGCAATGAATGGGACCACCTGGTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001862.3
Synonyms COXVB
Summary Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008]
Locus ID 1329
MW 11.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...