SGT1 (ECD) (NM_001135752) Human 3' UTR Clone

CAT#: SC200648

3' UTR clone of ecdysoneless homolog (Drosophila) (ECD) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SGT1 (ECD) (NM_001135752) Human 3' UTR Clone
Vector pMirTarget
Synonyms GCR2; HSGT1; SGT1
ACCN NM_001135752
Insert Size 132 bp
Sequence Data
>SC200648 3’UTR clone of NM_001135752
The sequence shown below is from the reference sequence of NM_001135752. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGACCAACAAGTAAGCCAACAAAAAATTAACCAGCACATTTAGCTTCTCTTTTTTCTTTTTAAATAAAT
ATTGAATATGATTCTGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135752.1
Synonyms GCR2; HSGT1; SGT1
Summary Regulator of p53/TP53 stability and function. Inhibits MDM2-mediated degradation of p53/TP53 possibly by cooperating in part with TXNIP (PubMed:16849563, PubMed:23880345). May be involved transcriptional regulation. In vitro has intrinsic transactivation activity enhanced by EP300. May be a transcriptional activator required for the expression of glycolytic genes (PubMed:19919181, PubMed:9928932). Involved in regulation of cell cycle progression. Proposed to disrupt Rb-E2F binding leading to transcriptional activation of E2F proteins (PubMed:19640839). The cell cycle -regulating function may depend on its RUVBL1-mediated association with the R2TP complex (PubMed:26711270). May play a role in regulation of pre-mRNA splicing (PubMed:24722212).[UniProtKB/Swiss-Prot Function]
Locus ID 11319
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...