IMMP1L (NM_144981) Human 3' UTR Clone

CAT#: SC200584

3' UTR clone of IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IMMP1L (NM_144981) Human 3' UTR Clone
Vector pMirTarget
Synonyms IMMP1; IMP1; IMP1-LIKE
ACCN NM_144981
Insert Size 129 bp
Sequence Data
>SC200584 3’UTR clone of NM_144981
The sequence shown below is from the reference sequence of NM_144981. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTAATGGCCACAGATTTTCTGATGATTAGTAAGCATTTATTCTTTTGACTTGATTATTGTCTCCTTTT
CATGTGAATTTATTACTCCCGTTGAAACCGTGTACTTACCAATAAACTATTTGCTATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_144981.3
Synonyms IMMP1; IMP1; IMP1-LIKE
Summary The mitochondrial inner membrane peptidase (IMP) complex generates mature, active proteins in the mitochondrial intermembrane space by proteolytically removing the mitochondrial targeting presequence of nuclear-encoded proteins. IMP1 and IMP2 (IMMP2L; MIM 605977) are the catalytic subunits of the IMP complex (Burri et al., 2005 [PubMed 15814844]).[supplied by OMIM, Sep 2008]
Locus ID 196294
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...