VRK2 (NM_001136027) Human 3' UTR Clone

CAT#: SC200545

3' UTR clone of vaccinia related kinase 2 (VRK2) transcript variant 6 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name VRK2 (NM_001136027) Human 3' UTR Clone
Vector pMirTarget
Synonyms vaccinia-related kinase-2; vaccinia related kinase 2; vaccinia virus B1R-related kinase 2
ACCN NM_001136027
Insert Size 125 bp
Sequence Data
>SC200545 3’UTR clone of NM_001136027
The sequence shown below is from the reference sequence of NM_001136027. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAGTATTTCTTGCTTTATTTTTTCTCTGAAGATGATACCAAAATTCCTTTTGATAATTTTTTAAGTTT
CCAGCTCTTCACCGAAATGTTGTATTCTTATTTCAGTGTTTCCTTCCAGACATTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001136027.1
Synonyms vaccinia-related kinase-2; vaccinia related kinase 2; vaccinia virus B1R-related kinase 2
Summary This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Locus ID 7444
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...