DIAPH2 (NM_007309) Human 3' UTR Clone

CAT#: SC200544

3' UTR clone of diaphanous homolog 2 (Drosophila) (DIAPH2) transcript variant 12C for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DIAPH2 (NM_007309) Human 3' UTR Clone
Vector pMirTarget
Synonyms DIA; DIA2; DRF2; POF; POF2; POF2A
ACCN NM_007309
Insert Size 123 bp
Sequence Data
>SC200544 3’UTR clone of NM_007309
The sequence shown below is from the reference sequence of NM_007309. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAAGGGCTAATCCAAGATCAGCTACATAAACGGCCTGAGTGCTGTTTTAAACAGGATTGGGTGATGGT
ACAACATGACTTTTTAAGATAATCAAGTAGTAAAAGTTTCTAGTGGAAACATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007309.4
Synonyms DIA; DIA2; DRF2; POF; POF2; POF2A
Summary The product of this gene belongs to the diaphanous subfamily of the formin homology family of proteins. This gene may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 1730
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...