Fibrillarin (FBL) (NM_001436) Human 3' UTR Clone

CAT#: SC200492

3' UTR clone of fibrillarin (FBL) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Fibrillarin (FBL) (NM_001436) Human 3' UTR Clone
Vector pMirTarget
Synonyms FIB; FLRN; Nop1; RNU3IP1
ACCN NM_001436
Insert Size 110 bp
Sequence Data
>SC200492 3’UTR clone of NM_001436
The sequence shown below is from the reference sequence of NM_001436. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAGGCCACCCCCCAAGGTGAAGAACTGAAGTTCAGCGCTGTCAGGATTGCGAGAGATGTGTGTTGAT
ACTGTTGCACGTGTGTTTTTCTATTAAAAGACTCATCCGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001436.4
Synonyms FIB; FLRN; Nop1; RNU3IP1
Summary This gene product is a component of a nucleolar small nuclear ribonucleoprotein (snRNP) particle thought to participate in the first step in processing preribosomal RNA. It is associated with the U3, U8, and U13 small nuclear RNAs and is located in the dense fibrillar component (DFC) of the nucleolus. The encoded protein contains an N-terminal repetitive domain that is rich in glycine and arginine residues, like fibrillarins in other species. Its central region resembles an RNA-binding domain and contains an RNP consensus sequence. Antisera from approximately 8% of humans with the autoimmune disease scleroderma recognize fibrillarin. [provided by RefSeq, Jul 2008]
Locus ID 2091
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...