MAP1S (NM_018174) Human 3' UTR Clone

CAT#: SC200463

3' UTR clone of microtubule-associated protein 1S (MAP1S) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MAP1S (NM_018174) Human 3' UTR Clone
Vector pMirTarget
Synonyms BPY2IP1; C19orf5; MAP8; VCY2IP-1; VCY2IP1
ACCN NM_018174
Insert Size 115 bp
Sequence Data
>SC200463 3’UTR clone of NM_018174
The sequence shown below is from the reference sequence of NM_018174. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTTCCCGGCCTGCAAGGTGGAGTTCTAGCCCCATCGCCGACACGCCCCCCACTCAGCCCAGCCCGCC
TGTCCCTAGATTCAGCCACATCAGAAATAAACTGTGACTACACTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018174.6
Synonyms BPY2IP1; C19orf5; MAP8; VCY2IP-1; VCY2IP1
Summary Microtubule-associated protein that mediates aggregation of mitochondria resulting in cell death and genomic destruction (MAGD). Plays a role in anchoring the microtubule organizing center to the centrosomes. Binds to DNA. Plays a role in apoptosis. Involved in the formation of microtubule bundles (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 55201
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...