MUC16 (NM_024690) Human 3' UTR Clone

CAT#: SC200446

3' UTR clone of mucin 16 cell surface associated (MUC16) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MUC16 (NM_024690) Human 3' UTR Clone
Vector pMirTarget
Synonyms CA125
ACCN NM_024690
Insert Size 118 bp
Sequence Data
>SC200446 3’UTR clone of NM_024690
The sequence shown below is from the reference sequence of NM_024690. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCACACCTAGACCTGGAGGATCTGCAATGACTGGAACTTGCCGGTGCCTGGGGTGCCTTTCCCCCAGCC
AGGGTCCAAAGAAGCTTGGCTGGGGCAGAAATAAACCATATTGGTCGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024690.2
Synonyms CA125
Summary This gene encodes a protein that is a member of the mucin family. Mucins are high molecular weight, O-glycosylated proteins that play an important role in forming a protective mucous barrier, and are found on the apical surfaces of the epithelia. The encoded protein is a membrane-tethered mucin that contains an extracellular domain at its amino terminus, a large tandem repeat domain, and a transmembrane domain with a short cytoplasmic domain. The amino terminus is highly glycosylated, while the repeat region contains 156 amino acid repeats unit that are rich in serines, threonines, and prolines. Interspersed within the repeats are Sea urchin sperm protein Enterokinase and Agrin (SEA) modules, leucine-rich repeats and ankyrin (ANK) repeats. These regions together form the ectodomain, and there is a potential cleavage site found near an SEA module close to the transmembrane domain. This protein is thought to play a role in forming a barrier, protecting epithelial cells from pathogens. Products of this gene have been used as a marker for different cancers, with higher expression levels associated with poorer outcomes. [provided by RefSeq, May 2017]
Locus ID 94025
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...