PPP1R14A (NM_033256) Human 3' UTR Clone

CAT#: SC200419

3' UTR clone of protein phosphatase 1 regulatory (inhibitor) subunit 14A (PPP1R14A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PPP1R14A (NM_033256) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPI-17; CPI17; PPP1INL
ACCN NM_033256
Insert Size 111 bp
Sequence Data
>SC200419 3’UTR clone of NM_033256
The sequence shown below is from the reference sequence of NM_033256. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGACCGGGCCCGGACTGCTCACCCCTGACCCTCTTGCACTCTCCCTGCCCCCCGGACGCCGCCCAGC
TTGCTTGTGTATAAGTTGTATTTAATGGTTCTGTAACAATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033256.3
Synonyms CPI-17; CPI17; PPP1INL
Summary The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011]
Locus ID 94274
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...