FMRFamide (NPFF) (NM_003717) Human 3' UTR Clone

CAT#: SC200418

3' UTR clone of neuropeptide FF-amide peptide precursor (NPFF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FMRFamide (NPFF) (NM_003717) Human 3' UTR Clone
Vector pMirTarget
Synonyms FMRFAL
ACCN NM_003717
Insert Size 118 bp
Sequence Data
>SC200418 3’UTR clone of NM_003717
The sequence shown below is from the reference sequence of NM_003717. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGCCCCTCAACGCTTTGGGAAGAAGTGACATGTCATCCCTTGATATGTCTGCATGCAAGGTCCACAC
CCAAAAGTGTCAATGTTTGCCCCCCAAATAAAATTGTCTGGCTTCTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003717.4
Synonyms FMRFAL
Summary This gene encodes a member of the FMRFamide related peptide (FARP) family of neuropeptides. The encoded preproprotein is proteolytically processed to generate multiple amidated peptides. These peptides may play a role in the regulation of heart rate and blood pressure and the modulation of morphine-induced antinociception. Patients with hypertension exhibit decreased expression of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Locus ID 8620
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...