Ribosomal protein S11 (RPS11) (NM_001015) Human 3' UTR Clone

CAT#: SC200409

3' UTR clone of ribosomal protein S11 (RPS11) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Ribosomal protein S11 (RPS11) (NM_001015) Human 3' UTR Clone
Vector pMirTarget
Synonyms S11
ACCN NM_001015
Insert Size 103 bp
Sequence Data
>SC200409 3’UTR clone of NM_001015
The sequence shown below is from the reference sequence of NM_001015. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCACCAAGAAGCAGTTCCAGAAGTTCTGAGGCTGGACATCGGCCCGCTCCCCACAATGAAATAAAGTT
ATTTTCTCATTCCCAGGCCAGACTTGGGATCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001015.5
Synonyms S11
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S17P family of ribosomal proteins that is a component of the 40S subunit. This gene is co-transcribed with the small nucleolar RNA gene U35B, which is located in the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]
Locus ID 6205
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...