RLTPR (CARMIL2) (NM_001013838) Human 3' UTR Clone

CAT#: SC200404

3' UTR clone of RGD motif leucine rich repeats tropomodulin domain and proline-rich containing (RLTPR) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RLTPR (CARMIL2) (NM_001013838) Human 3' UTR Clone
Vector pMirTarget
Synonyms CARMIL2b; IMD58; LRRC16C; RLTPR
ACCN NM_001013838
Insert Size 81 bp
Sequence Data
>SC200404 3’UTR clone of NM_001013838
The sequence shown below is from the reference sequence of NM_001013838. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCAAAGAGGCGGCGGCCCCAATCCCTGATCCTCTCCTCTCCTGCCGCATGAGATTATTTTATTAAAA
AACTCAAAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001013838.3
Synonyms CARMIL2b; IMD58; LRRC16C; RLTPR
Summary This gene encodes a member of the CARMIL (capping protein, Arp2/3, myosin-I linker) family of proteins. The encoded protein interacts with and negatively regulates the heterodimeric capping protein and promotes cell migration. Reduced expression of this gene has been observed in human psoriasis patients. Mutations in this gene cause a human immunodeficiency syndrome characterized by smooth muscle tumors and impaired T-cell function. [provided by RefSeq, May 2017]
Locus ID 146206
MW 2.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...