ANTXR2 (NM_001145794) Human 3' UTR Clone

CAT#: SC200375

3' UTR clone of anthrax toxin receptor 2 (ANTXR2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ANTXR2 (NM_001145794) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMG-2; CMG2; HFS; ISH; JHF
ACCN NM_001145794
Insert Size 83 bp
Sequence Data
>SC200375 3’UTR clone of NM_001145794
The sequence shown below is from the reference sequence of NM_001145794. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAATGTATTGAGAAAGAGCTAACTGCTTGAGTCAGTATAATGGAGGCAGGGAAATAGTAATAAAAAATG
ATTTTAAAGCCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145794.2
Synonyms CMG-2; CMG2; HFS; ISH; JHF
Summary This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Locus ID 118429
MW 3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...