XRCC1 (NM_006297) Human 3' UTR Clone

CAT#: SC200358

3' UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 1 (XRCC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name XRCC1 (NM_006297) Human 3' UTR Clone
Vector pMirTarget
Synonyms RCC; SCAR26
ACCN NM_006297
Insert Size 111 bp
Sequence Data
>SC200358 3’UTR clone of NM_006297
The sequence shown below is from the reference sequence of NM_006297. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCTCTATGGGGTGGTGCCGCAAGCCTGAAGTATGTGCTATACACACACACACACACACACACACACA
CACACACACACGATGCATTTAATAAAGATGAGTTGGTTCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006297.3
Synonyms RCC; SCAR26
Summary The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
Locus ID 7515
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...