OBSCN (NM_001098623) Human 3' UTR Clone

CAT#: SC200340

3' UTR clone of obscurin cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name OBSCN (NM_001098623) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARHGEF30; UNC89
ACCN NM_001098623
Insert Size 109 bp
Sequence Data
>SC200340 3’UTR clone of NM_001098623
The sequence shown below is from the reference sequence of NM_001098623. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAGGCACAACCTGGCCCAGGTGCGCTGAGGGTCGCCCCGGCCACACCCTTGGTCTCCCCGCTGGGGG
TCGCTGCAGACGCGCCAATAAAAACGCACAGCCGGGCGAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001098623.2
Synonyms ARHGEF30; UNC89
Summary The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 720 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein belongs to the family of giant sacromeric signaling proteins that includes titin and nebulin, and may have a role in the organization of myofibrils during assembly and may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 84033
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...