HBM (NM_001003938) Human 3' UTR Clone

CAT#: SC200282

3' UTR clone of hemoglobin mu (HBM) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HBM (NM_001003938) Human 3' UTR Clone
Vector pMirTarget
Synonyms HBAP2; HBK
ACCN NM_001003938
Insert Size 86 bp
Sequence Data
>SC200282 3’UTR clone of NM_001003938
The sequence shown below is from the reference sequence of NM_001003938. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGTGGTGCTGACCGAAAAATACCGCTGAGCCCTGTGCTGCGCAGGCCTTGGTCTGTGCCTGTCAATA
AACAGAGGCCCGAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001003938.4
Synonyms HBAP2; HBK
Summary The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. This gene has an ORF encoding a 141 aa polypeptide which is similar to the delta globins found in reptiles and birds. This locus was originally described as a pseudogene; however, it is currently thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Locus ID 3042
MW 3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...