CLIC3 (NM_004669) Human 3' UTR Clone

CAT#: SC200263

3' UTR clone of chloride intracellular channel 3 (CLIC3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CLIC3 (NM_004669) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_004669
Insert Size 103 bp
Sequence Data
>SC200263 3’UTR clone of NM_004669
The sequence shown below is from the reference sequence of NM_004669. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTACCGGCCCGCCGTGCACCCCCGCTAGCGCCCCACCCCGCGTCTGTCGCCCAATAAAGGCATCTTT
GTCGGGAGTGAGGGTGTCCTGACATCTGAAGGGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004669.3
Summary Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Locus ID 9022
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...