Sperm Flagellar 2 (SPEF2) (NM_024867) Human 3' UTR Clone

CAT#: SC200243

3' UTR clone of sperm flagellar 2 (SPEF2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Sperm Flagellar 2 (SPEF2) (NM_024867) Human 3' UTR Clone
Vector pMirTarget
Synonyms CT122; KPL2; SPGF43
ACCN NM_024867
Insert Size 88 bp
Sequence Data
>SC200243 3’UTR clone of NM_024867
The sequence shown below is from the reference sequence of NM_024867. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTTCAAGACATACAGAGGAAAAGAAATGAAGACAAAAGAGTGTGATTTTTTTAATTCTGCAATAAATC
TTCCAAAAATTAAATGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024867.4
Synonyms CT122; KPL2; SPGF43
Summary Required for correct axoneme development in spermatozoa. Important for normal development of the manchette and sperm head morphology. Essential for male fertility. Plays a role in localization of the intraflagellar transport protein IFT20 to the manchette, suggesting function as an adapter for dynein-mediated protein transport during spermatogenesis. Also plays a role in bone growth where it seems to be required for normal osteoblast differentiation.[UniProtKB/Swiss-Prot Function]
Locus ID 79925
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...