CNOT1 (NM_206999) Human 3' UTR Clone

CAT#: SC200238

3' UTR clone of CCR4-NOT transcription complex subunit 1 (CNOT1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CNOT1 (NM_206999) Human 3' UTR Clone
Vector pMirTarget
Synonyms AD-005; CDC39; HPE12; NOT1; NOT1H
ACCN NM_206999
Insert Size 262 bp
Sequence Data
>SC200238 3’UTR clone of NM_206999
The sequence shown below is from the reference sequence of NM_206999. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTCTGTTATATTCTCAACACGATGTTTGACAGATAGTAGATACCCAAATATTTGTTGGTTTAAATAAA
TTAAGATTTAAAAAGGAAATGTGATATCTGACAATCTCATTTCTGTTAACCAGGAAGGATGAAAGCTGT
TTGAGAAGGCCGATACAAAATGACTTAAAGTGATGTTGCATGTGCACACACTTTTCAAATAATTCACTT
ACTAGTTTTGAGTCTCAGATATCATGGTTAATAATTCAGGTATCATGATTAATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_206999.3
Synonyms AD-005; CDC39; HPE12; NOT1; NOT1H
Summary Scaffolding component of the CCR4-NOT complex which is one of the major cellular mRNA deadenylases and is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. Additional complex functions may be a consequence of its influence on mRNA expression. Its scaffolding function implies its interaction with the catalytic complex module and diverse RNA-binding proteins mediating the complex recruitment to selected mRNA 3' UTRs. Involved in degradation of AU-rich element (ARE)-containing mRNAs probably via association with ZFP36. Mediates the recruitment of the CCR4-NOT complex to miRNA targets and to the RISC complex via association with TNRC6A, TNRC6B or TNRC6C. Acts as a transcriptional repressor. Represses the ligand-dependent transcriptional activation by nuclear receptors. Involved in the maintenance of embryonic stem (ES) cell identity.[UniProtKB/Swiss-Prot Function]
Locus ID 23019
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...