RPL36 (NM_033643) Human 3' UTR Clone

CAT#: SC200193

3' UTR clone of ribosomal protein L36 (RPL36) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL36 (NM_033643) Human 3' UTR Clone
Vector pMirTarget
Synonyms L36
ACCN NM_033643
Insert Size 284 bp
Sequence Data
>SC200193 3’UTR clone of NM_033643
The sequence shown below is from the reference sequence of NM_033643. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGAGGAAAGCTGCTGCCAAGAAAGACTGAGCCCCTCCCCTGCCCTCTCCCTGAAATAAAGAACAGCTT
GACAGAAGCCCTGGCTCTCCTGCTGTCCGTGGGTGGGTGTGGGTGTGTCGGGGGCCCGCAGTCCCCTGT
CTGGTGCCCGCTCTGAGCCACACCCTCTCCGGGTGCTGCCTGGTCGTGAATCAAAAGCCGTGGCCCGCC
CACCCTTCCCGGGGCAGCAGGTGAGGAAGCCGCCGTACTGCAAATGACTTTAATCATTAAATAGCTTCT
ATGCCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033643.3
Synonyms L36
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L36E family of ribosomal proteins. It is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 25873
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...