ALKBH7 (NM_032306) Human 3' UTR Clone

CAT#: SC200061

3' UTR clone of alkB alkylation repair homolog 7 (E. coli) (ALKBH7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ALKBH7 (NM_032306) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABH7; SPATA11; UNQ6002
ACCN NM_032306
Insert Size 307 bp
Sequence Data
>SC200061 3’UTR clone of NM_032306
The sequence shown below is from the reference sequence of NM_032306. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTCTGGACAGCCGCCCCCAGCCTGCTGACCCCCAGCTTTCTACAGACACCAGATTTGTGAATAAAGT
TGGGGAATGGACAGCCTAACTGGGACATTGCAGTGGCTGCTTGCTGGGGCCGGGATTTGCAGGGGAACC
CAGGATGGCACTGGCCCATAGGGAGCTCCAGGTGTGGCTGGCTGGACACATGGTCAAAGTCACAAGGCC
GGGAGAGTGGTGTCCTTTATTGCACTCACTGCTGGTCGCCCCAGCCCACTCCCCTCCTCGTTGTCTCTG
CATCCAGGTCTCCAATAAATAAGTCAGCCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032306.4
Synonyms ABH7; SPATA11; UNQ6002
Summary May function as protein hydroxylase; can catalyze auto-hydroxylation at Leu-110 (in vitro), but this activity may be due to the absence of the true substrate (PubMed:25122757). Required to induce programmed necrosis in response to DNA damage caused by cytotoxic alkylating agents. Acts by triggering the collapse of mitochondrial membrane potential and loss of mitochondrial function that leads to energy depletion and cell death (PubMed:23666923). ALKBH7-mediated necrosis is probably required to prevent the accumulation of cells with DNA damage (PubMed:23666923). Does not display DNA demethylase activity (PubMed:23666923). Involved in fatty acid metabolism (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 84266
MW 10.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...