MED25 (NM_030973) Human 3' UTR Clone

CAT#: SC200040

3' UTR clone of mediator complex subunit 25 (MED25) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MED25 (NM_030973) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACID1; ARC92; BVSYS; CMT2B2; P78; PTOV2; TCBAP0758
ACCN NM_030973
Insert Size 65 bp
Sequence Data
>SC200040 3’UTR clone of NM_030973
The sequence shown below is from the reference sequence of NM_030973. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGACGACATCCTCATGGATCTCATCTGAATCCCCAACACCCAATAAAGTTCCTTTTTAACACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_030973.4
Synonyms ACID1; ARC92; BVSYS; CMT2B2; P78; PTOV2; TCBAP0758
Summary This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]
Locus ID 81857
MW 2.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...