GCSF Receptor (CSF3R) (NM_172313) Human 3' UTR Clone

CAT#: SC200036

3' UTR clone of colony stimulating factor 3 receptor (granulocyte) (CSF3R) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GCSF Receptor (CSF3R) (NM_172313) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD114; GCSFR; SCN7
ACCN NM_172313
Insert Size 83 bp
Sequence Data
>SC200036 3’UTR clone of NM_172313
The sequence shown below is from the reference sequence of NM_172313. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCTTGTTTCCTATAACTTCAGTATTGTAAACTAGTTTTTGGTTTGCAGTTTTTGTTGTTGTTTATAGA
CACTCTTGGGTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172313.3
Synonyms CD114; GCSFR; SCN7
Summary The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
Locus ID 1441
MW 3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...