RPL18A (NM_000980) Human 3' UTR Clone

CAT#: SC200024

3' UTR clone of ribosomal protein L18a (RPL18A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL18A (NM_000980) Human 3' UTR Clone
Vector pMirTarget
Synonyms L18A
ACCN NM_000980
Insert Size 86 bp
Sequence Data
>SC200024 3’UTR clone of NM_000980
The sequence shown below is from the reference sequence of NM_000980. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCACCAAGAGGCCCAACACCTTCTTCTAGGTGCAGGGCCCTCGTCCGGGTGTGCCCCAAATAAACTCA
GGAACGCCCCGGTGCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000980.4
Synonyms L18A
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18AE family of ribosomal proteins that is a component of the 60S subunit. The encoded protein may play a role in viral replication by interacting with the hepatitis C virus internal ribosome entry site (IRES). This gene is co-transcribed with the U68 snoRNA, located within the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]
Locus ID 6142
MW 3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...