Retinoid X Receptor beta (RXRB) (NM_001291989) Human Untagged Clone

CAT#: SC335516

RXRB (untagged) - Human retinoid X receptor, beta (RXRB), transcript variant 3



  "NM_001291989" in other vectors (2)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RXRB Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DAUDI6; H-2RIIBP; NR2B2; RCoR-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335516 representing NM_001291989.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCGAGTGTGGAGGTGGCCCTGGGGCTGGCAAACGGCTATGTGCAATCTGCGGGGACAGAAGCTCA
GGCAAACACTACGGGGTTTACAGCTGTGAGGGTTGCAAGGGCTTCTTCAAACGCACCATCCGCAAAGAC
CTTACATACTCTTGCCGGGACAACAAAGACTGCACAGTGGACAAGCGCCAGCGGAACCGCTGTCAGTAC
TGCCGCTATCAGAAGTGCCTGGCCACTGGCATGAAGAGGGAGGCGGTACAGGAGGAGCGTCAGCGGGGA
AAGGACAAGGATGGGGATGGGGAGGGGGCTGGGGGAGCCCCCGAGGAGATGCCTGTGGACAGGATCCTG
GAGGCAGAGCTTGCTGTGGAACAGAAGAGTGACCAGGGCGTTGAGGGTCCTGGGGGAACCGGGGGTAGC
GGCAGCAGCCCAAATGACCCTGTGACTAACATCTGTCAGGCAGCTGACAAACAGCTATTCACGCTTGTT
GAGTGGGCGAAGAGGATCCCACACTTTTCCTCCTTGCCTCTGGATGATCAGGTCATATTGCTGCGGGCA
GGCTGGAATGAACTCCTCATTGCCTCCTTCTCACACCGATCCATTGATGTTCGAGATGGCATCCTCCTT
GCCACAGGTCTTCACGTGCACCGCAACTCAGCCCATTCAGCAGGAGTAGGAGCCATCTTTGATCGGTCC
CTCTCCAGGGTGCTGACAGAGCTAGTGTCCAAAATGCGTGACATGAGGATGGACAAGACAGAGCTTGGC
TGCCTGAGGGCAATCATTCTGTTTAATCCAGATGCCAAGGGCCTCTCCAACCCTAGTGAGGTGGAGGTC
CTGCGGGAGAAAGTGTATGCATCACTGGAGACCTACTGCAAACAGAAGTACCCTGAGCAGCAGGGACGG
TTTGCCAAGCTGCTGCTACGTCTTCCTGCCCTCCGGTCCATTGGCCTTAAGTGTCTAGAGCATCTGTTT
TTCTTCAAGCTCATTGGTGACACCCCCATCGACACCTTCCTCATGGAGATGCTTGAGGCTCCCCATCAA
CTGGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291989
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291989.1
RefSeq Size 2212 bp
RefSeq ORF 1044 bp
Locus ID 6257
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, Non-small cell lung cancer, Pathways in cancer, PPAR signaling pathway, Small cell lung cancer, Thyroid cancer
MW 38.5 kDa
Gene Summary This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...