JPH3 (NM_001271605) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CAGL237; HDL2; JP-3; JP3; TNRC22
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333068 representing NM_001271605. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCAGTGGGGGCAGGTTTAATTTTGACGACGGAGGGTCCTACTGTGGAGGCTGGGAGGACGGCAAG GCGCACGGCCATGGCGTCTGCACCGGCCCCAAGGGCCAAGGCGAATACACCGGCTCGTGGAGCCACGGC TTCGAGGTGCTGGGCGTCTACACCTGGCCCAGCGGCAACACGTACCAGGGCACCTGGGCGCAGGGCAAG CGCCACGGCATCGGCCTGGAGAGCAAGGGGAAGTGGGTGTACAAGGGCGAGTGGACGCACGGATTCAAG GGGCGCTACGGGGTGCGGGAGTGCGCGGGCAACGGGGCCAAATACGAAGGGACCTGGAGCAACGGGCTG CAGGACGGCTACGGGACCGAGACCTACTCGGACGGAGGTGGTTGGACGCGGACTAGCGCTGTCGAAGCA GGCTGCTGGAGGGAGGAGGGAGGCCCATCTGCTCAGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001271605
Insert Size	453 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001271605.1
RefSeq Size	1238 bp
RefSeq ORF	453 bp
Locus ID	57338
Protein Families	Druggable Genome, Transmembrane
MW	16.1 kDa
Gene Summary	Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon compared to variant 1. The latter results in a frame-shift and a much shorter isoform (3) with a distinct C-terminus compared to isoform 1. This variant is described in PMID:11694876.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.