IL1 Receptor II (IL1R2) (NM_001261419) Human Untagged Clone

CAT#: SC332768

IL1R2 (untagged) - Homo sapiens interleukin 1 receptor, type II (IL1R2), transcript variant 3



  "NM_001261419" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
IL1R2 mouse monoclonal antibody, clone OTI3C6 (formerly 3C6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD121b; CDw121b; IL-1R-2; IL-1RT-2; IL-1RT2; IL1R2c; IL1RB
Vector pCMV6-Entry
Sequence Data
>SC332768 representing NM_001261419.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTGCGCTTGTACGTGTTGGTAATGGGAGTTTCTGCCTTCACCCTTCAGCCTGCGGCACACACAGGG
GCTGCCAGAAGCTGCCGGTTTCGTGGGAGGCATTACAAGCGGGAGTTCAGGCTGGAAGGGGAGCCTGTA
GCCCTGAGGTGCCCCCAGGTGCCCTACTGGTTGTGGGCCTCTGTCAGCCCCCGCATCAACCTGACATGG
CATAAAAATGACTCTGCTAGGACGGTCCCAGGAGAAGAAGAGACACGGATGTGGGCCCAGGACGGTGCT
CTGTGGCTTCTGCCAGCCTTGCAGGAGGACTCTGGCACCTACGTCTGCACTACTAGAAATGCTTCTTAC
TGTGACAAAATGTCCATTGAGCTCAGAGTTTTTGAGAATACAGATGCTTTCCTGCCGTTCATCTCATAC
CCGCAAATTTTAACCTTGTCAACCTCTGGGGTATTAGTATGCCCTGACCTGAGTGAATTCACCCGTGAC
AAAACTGACGTGAAGATTCAATGGTACAAGGATTCTCTTCTTTTGGATAAAGACAATGAGAAATTTCTA
AGTGTGAGGGGGACCACTCACTTACTCGTACACGATGTGGCCCTGGAAGATGCTGGCTATTACCGCTGT
GTCCTGACATTTGCCCATGAAGGCCAGCAATACAACATCACTAGGAGTATTGAGCTACGCATCAAGAAA
AAAAAAGAAGAGACCATTCCTGTGATCATTTCCCCCCTCAAGACCATATCAGCTTCTCTGGGGTCAAGA
CTGACAATCCCGTGTAAGGTGTTTCTGGGAACCGGCACACCCTTAACCACCATGCTGTGGTGGACGGCC
AATGACACCCACATAGAGAGCGCCTACCCGGGAGGCCGCGTGACCGAGGGGCCACGCCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001261419
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001261419.1
RefSeq Size 1204 bp
RefSeq ORF 891 bp
Locus ID 7850
UniProt ID P27930
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, MAPK signaling pathway
MW 33.6 kDa
Gene Summary The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) lacks multiple 3' exons and has an alternate 3' splice site which introduces an immediate stop codon, compared to variant 1. The encoded protein (isoform 2) has a shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...