Retinoid X Receptor gamma (RXRG) (NM_001256570) Human Untagged Clone

CAT#: SC332420

RXRG (untagged) - Homo sapiens retinoid X receptor, gamma (RXRG), transcript variant 3



  "NM_001256570" in other vectors (2)

CNY 3,330.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Retinoid X Receptor gamma antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NR2B3; RXRC
Vector pCMV6-Entry
Sequence Data
>SC332420 representing NM_001256570.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACTACCCATCCACCAGCCCCGGATCTCTGGTTAAACACATCTGTGCCATCTGTGGAGACAGATCC
TCAGGAAAGCACTACGGGGTATACAGTTGTGAAGGCTGCAAAGGGTTCTTCAAGAGGACGATAAGGAAG
GACCTCATCTACACGTGTCGGGATAATAAAGACTGCCTCATTGACAAGCGTCAGCGCAACCGCTGCCAG
TACTGTCGCTATCAGAAGTGCCTTGTCATGGGCATGAAGAGGGAAGCTGTGCAAGAAGAAAGACAGAGG
AGCCGAGAGCGAGCTGAGAGTGAGGCAGAATGTGCTACCAGTGGTCATGAAGACATGCCTGTGGAGAGG
ATTCTAGAAGCTGAACTTGCTGTTGAACCAAAGACAGAATCCTATGGTGACATGAATATGGAGAACTCG
ACAAATGACCCTGTTACCAACATATGTCATGCTGCTGACAAGCAGCTTTTCACCCTCGTTGAATGGGCC
AAGCGTATTCCCCACTTCTCTGACCTCACCTTGGAGGACCAGGTCATTTTGCTTCGGGCAGGGTGGAAT
GAATTGCTGATTGCCTCTTTCTCCCACCGCTCAGTTTCCGTGCAGGATGGCATCCTTCTGGCCACGGGT
TTACATGTCCACCGGAGCAGTGCCCACAGTGCTGGGGTCGGCTCCATCTTTGACAGAGTCCTAACTGAG
CTGGTTTCCAAAATGAAAGACATGCAGATGGACAAGTCGGAACTGGGATGCCTGCGAGCCATTGTACTC
TTTAACCCAGATGCCAAGGGCCTGTCCAACCCCTCTGAGGTGGAGACTCTGCGAGAGAAGGTTTATGCC
ACCCTTGAGGCCTACACCAAGCAGAAGTATCCGGAACAGCCAGGCAGGTTTGCCAAGCTGCTGCTGCGC
CTCCCAGCTCTGCGTTCCATTGGCTTGAAATGCCTGGAGCACCTCTTCTTCTTCAAGCTCATCGGGGAC
ACCCCCATTGACACCTTCCTCATGGAGATGTTGGAGACCCCGCTGCAGATCACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256570
Insert Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256570.1
RefSeq Size 2263 bp
RefSeq ORF 1023 bp
Locus ID 6258
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, Non-small cell lung cancer, Pathways in cancer, PPAR signaling pathway, Small cell lung cancer, Thyroid cancer
MW 38.6 kDa
Gene Summary This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (3) includes an additional exon in its 5' UTR, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as RXRgamma2) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Retinoid X Receptor gamma产品

Customer Reviews 
Loading...